Posts containing the following tags:
culture

''Through this plan we are setting an ambitious goal: All students should graduate from high school prepared for college and a career – no matter who you are or where you come from.'' President Obama, March 13, 2010 Mr. President, can we cut through the crap? I'm a retired pediatrician. A lot of children are damaged--some by bad luck, ...

When nothing else subsists from the past, after the people are dead, after the things are broken and scattered· the smell and taste of things remain poised a long time, like souls· bearing resiliently, on tiny and almost impalpable drops of their essence, the immense edifice of memory. Marcel Proust, The Remembrance of Things Past A couple of ...

We're testing this week, and I'm cranky. Correlation? We also believe that if we want to improve student outcomes, especially in high-poverty schools, nothing is more important than ensuring that there are effective teachers in every classroom and effective leaders in every school. Arne the Scarecrow, March 3, 2010 House Committee on Education ...

I just read a fun post tweeted by dtitle, ''Five amazing inventions that will doom us all!'' Why wait for the future, though? We already have all kinds of technological doo-dads that have doomed humanity (if not humans): Number Five: Television (and other forms of e-media) Very few folks control television, and very few appreciate how this ...

Vision: A quality science education fosters a population that...applies scientific knowledge and skills to increase economic productivity. 2009 NJ Core Curriculum Content Standards I am a science teacher, and occasionally a good one. I am certified by the state of New Jersey (Liberty and Prosperity), and paid by the Township of Bloomfield, ...

Schools were designed by Horace Mann and Barnas Sears and W.R. Harper of the University of Chicago and Edward Thorndike of Columbia Teachers College and other to be instruments for the scientific management of a mass population. Schools are intended to produce, through the application of formulas, formulaic human beings whose behavior can be ...

Poor little rich kid. Mr. Duncan is going to take a lot of flak for his Katrina komment, joining the Brownie School of Fixing by Diaspora, but he's already getting blog-flogged for that. No, I'm more interested in the psychology of Duncan Dogooder, trying to anticipate how much damage this poor little rich kid is going to inflict on public ...

One of the definitions of sanity is the ability to tell real from unreal. Soon we'll need a new definition. Alvin Toffler In two seemingly unrelated news items, we learn that kids spend about 7 1/2 hours plugged into media every day, and that corporations, blessed with the same rights of more corporeal citizens, will be allowed to run ads directly ...

GCAGTAATGACGCTGGGCGAAATACGTCCGAAGCAACTGTTGGTG If you string the above sequence of DNA bases in a crab, you get a piece of crabbiness. AGGTTTGGTCCTAGCCTTTCTATTAGCTCTTAGTAAGATTACAC If you string the above sequence, you get a piece of humanness. Nothing startling to a high school sophomore. If, however, you put the piece of crabbiness into the ...

Mr. McGuire: I just want to say one word to you - just one word. Ben: Yes sir. Mr. McGuire: Are you listening? Ben: Yes I am. Mr. McGuire: 'Plastics.' A few years ago, when I was still playing doctor, the FDA released a ''Public Health Notification'' regarding plasticizers in IV tubing. Back in 2002, when King W sat on the throne, the ...